                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-17.60 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-17.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGCTACGTGATCGACACGCCGGGCATCCGCGAGTTCAACCTTGCCGGCATCACCCG
CGAGAACCTGCGGTTCTACTACACGGAGTTCCTGCGCTACATGCCGGAGTGCACCTTT
TCATCCTGCTCGCACACGGTCGAACCGGGTTGTGCCGTGATCGCGGCGGTCGAGTCGG
GATCCATCGCCCGGGAGCGCTACGAGAGCTACCTCGCCCTGCTCGATTCGCTCGCCGA
GTAAgtctggcgcggtggccgcactgagatcagaacctttattggaacatcaaaaagaacgcagagatATG

    CT1573 --- CT1572 Gene: CT1573     GI: 21674391     BI number: CT1573     GOG: COG1012     Description: aldehyde dehydrogenase family protein Gene: CT1572     GI: 21674390     BI number: CT1572     GOG: NOG28274     Description: hypothetical protei CC A  T T  C CG         C GC       G  C |  C       CG |  C       TA |  T       CG A  G      G  T GC       C  A AT        TA        cc GC        Tg       g  g CG        At        gc A  A       Gc        ta T  T      C  t       gc C  T       Tg        gt GC        Cg        cg CG        Gc       |  a GC        Tg       g  g AT       C  c      c  a GC        Cg        gt |  G       Cg        gc GC        Gt        ta GC        Cg        cg CG        Tg        ta                         acctttattggaacatcaaaaagaacgcagagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................