                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-16.40 kcal/mol
Anti-antiterminator:   Size=74 nt.     Delta G= -8.25 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGACATCATGCGCGCGGCGCGGGCGGCGGCCTTCGAGCTGATCCGCCGCGACGAAAC
GCTCACACACCCCGAAAATGCCCTGATCAGGGATTATTATATGACCCACTTCCGCAAG
CGAATCTCGCTGGCTGATGTCGGGTGAttgccggattgcccgattttcttgctccattcatattcaccagatgctgttcg
tggaaagtgaaatgcttatattttcttccttttggagcttcgcttcttgccggactgtcgatgaacgtcgtgttggccggtgataatcagcacagccttt
ttgcATG

    CT1574 Gene: CT1574     GI: 21674392     BI number: CT1574     GOG: COG1162     Description: conserved hypothetical protei AT G  C TA CG CG CG G  A T  T A  T A  A A  T A  T G  A C  T C  A C  | C  | A  | C  | A  | C  | AT         T CG       A  C TA       A  T |  C       GC C  C       CG G  C       GC C  A       AT A  C      A  G AT        CG        cc AT        GC       g  g GC       C  T       tg C  |       CG        ta A  |       TA        At GC       T  T      G  t CG        CG       T  g GC        AT        Gc |  A      |  C       Gc C  A       CG        Gc CG        CG        Cg GC        CG        Ta CG        AT        Gt                         tttcttgctccattcatattcaccagatgctgttcgtggaaagtgaaatgcttatattttcttccttttggagcttcgcttcttgccggactgtcgatgaacgtcgtgttggccggtgataatcagcacagcctttttgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1162 Predicted GTPases ... can be seen here     ..................................................................................................................