                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGATGACCACTCGTGGGATGAAGGTTGCCGAAGCTGAAAAGATCGTTGAATTCATC
GATCGCGTCATCAGCGCTGCCAACGACGCCAACGTCGCCGATGTCTGCAAGGCCGTCA
GGGCTGAAGTTCGCGAGCTGTGCCTTGGCTTCCCGCTCAACAACTACGGTTCTCTCGT
CTAAgtgatatgcgataaagtattacaaaggccggtcatctctgtggacgccggccttttttgtcttttttataataaatttactatcaccattggt
taagtccttgccaagaaaaaaagggtgccATG

    CT1589 Gene: CT1589     GI: 21674407     BI number: CT1589     GOG: -------     Description: hypothetical protei   C T  T T  C       at GT       g  a GC       c  a CG       g  a AT        tg        tg |  C       at       c  t |  T       ta        tg |  A       at        cg TA        gt        ta Cg        ta       a  c At        gc       c  | A  g      A  a       tg C  a      A  a       gc A  t       Ta        gc A  a       Cg        cg C  t       Tg        cg T  |       Gc        gc Cg       C  c       gc Gc        Tg        at Cg        Cg        at                         ttttgtcttttttataataaatttactatcaccattggttaagtccttgccaagaaaaaaagggtgccATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.90 kcal/mol Antiterminator: Size=40 nt.     Delta G= -8.60 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G= -4.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGCGATGACCACTCGTGGGATGAAGGTTGCCGAAGCTGAAAAGATCGTTGAATTCATC GATCGCGTCATCAGCGCTGCCAACGACGCCAACGTCGCCGATGTCTGCAAGGCCGTCA GGGCTGAAGTTCGCGAGCTGTGCCTTGGCTTCCCGCTCAACAACTACGGTTCTCTCGT CTAAgtgatatgcgataaagtattacaaaggccggtcatctctgtggacgccggccttttttgtcttttttataataaatttactatcaccattggt taagtccttgccaagaaaaaaagggtgccATG     CT1589 Gene: CT1589     GI: 21674407     BI number: CT1589     GOG: -------     Description: hypothetical protei   C T  C T  C       at CG       g  a GC       c  a GT       g  a TC        tg        tg |  A       at       c  t |  A       ta        tg |  C       at        cg TA        gt        ta CA        ta       a  c CC        gc       c  | G  T      A  a       tg T  A      A  a       gc G  C       Ta        gc T  G       Cg        cg C  G       Tg        cg G  |       Gc        gc AT       C  c       gc GT        Tg        at CC        Cg        at                         ttttgtcttttttataataaatttactatcaccattggttaagtccttgccaagaaaaaaagggtgccATG     ..................................................................................................................