                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-10.54 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGCGCCATCGAGTCCGGGCCGCCGGAAACGGCCAGCAGCACCGCGTCGCCGTTCGC
GACAAGCTTCTGCCGATGCATGTTTTCAAGAAATTTTTTCTCGGTCTTGTTCACtggatc
gtttgtcgatttgctcgatgtggaattggcgctcgatgcggcactcccggccatcgcagagcatcataatatatacgctcggccgtttttgcaatcccga
caacggcctgccgaccgggtgcaatgatggtaaataagacaaatttggctatcataaagcctgaaatcaggattataagctcATG

    CT1615 Gene: CT1615     GI: 21674433     BI number: CT1615     GOG: COG0688     Description: conserved hypothetical protei   g c  a t  t        c cg       t  c       at gt       c  c      a  a |  g      a  g      t  t tg        cg       a  a ta        gc       c  t ta        gc       t  a at       |  a      a  c gt       |  t       cg cg       |  c       gc tg        cg        at gc        gc        gc tg        ta       a  | t  c      a  |      c  | t  t      g  |      g  | gc        cg       c  | cg        ta       t  | ta        cg       a  | at        gc        cg g  g      c  a       cg gc       g  t       gc tg        gc        gc Cg        ta        cg                         tttttgcaatcccgacaacggcctgccgaccgggtgcaatgatggtaaataagacaaatttggctatcataaagcctgaaatcaggattataagctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0688 Phosphatidylserine decarboxylase ... can be seen here     ..................................................................................................................