                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-12.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -4.32 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCAGGAGGTGGCCTCCGGCAAACGATTCGGCATGATAAAGCTCGGATCGAGAGTTG
ACATTGTCCTCCCCTCCTCGATACAGATCAAGGTTAAGGAGGGGATGAAAACCACCGC
AGGCGAAACAATTTTGGGCCAGACCGGAGGTTTTTGAtcgaaaactttttggtttcaagaccttctttgttaa
gttttcattgcaatcacacacagtctaccagcgccatgaaacagtaatcgctcaattgcagcgcaatcgtttcaagacgcatctatttgtacactttccg
gagatacatccATG

    CT1616 Gene: CT1616     GI: 21674434     BI number: CT1616     GOG: COG1826     Description: Sec-independent protein translocase protein TatE, putativ GA T  A A  A G  A GC GC G  A       CA A  |      C  G GC       G  A        c GC        GC       a  t |  G       GC        at |  C       TG        at |  A       TG        at |  G       TA        gt |  G       TG        cg |  C      A  G       tg |  G      A  T       At |  A      C  |       Gt |  A       AT       |  t A  A       AT       T  c A  C       AT        Ta TA        GT        Ta TA        CG        Tg GT       G  A       Ta GT       G  t       Gc AT       A  |       Gc AT       C  |       At CG        Gc        Gt TG        Cg        Gc                         tttgttaagttttcattgcaatcacacacagtctaccagcgccatgaaacagtaatcgctcaattgcagcgcaatcgtttcaagacgcatctatttgtacactttccggagatacatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG1826 Sec-independent protein secretion pathway components ... can be seen here     ..................................................................................................................