                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:4 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTTTATGGCGTGATGTACAAGAATATCGTTTTGAAAAGTGAAATGGGCAGCATCTCC
ACGAAAGCGGCAAGCATCGAGGAAAACGTCGTCGGTTCGGCGTCGAAATTCGCGATTC
CGGCGCGCCACACCGTTCAGGAGGTCAATGTTGCCGAGGAGATGGAGAAAGCCGCAAA
TGGTGGGTCAGGAGAGTAAcgtcaccatgcaagtccatagccggtaacgcgatggccggtttttgcattacagcgaaaggaaaaaa
ggcggtgcttgtgccgccttttttatgattttttccagggGTG

    CT1619 Gene: CT1619     GI: 21674437     BI number: CT1619     GOG: -------     Description: hypothetical protei            ta           t  c   c       a  a g  g       cg c  a       gc a  t       tg a  g       ta tg        ta gc        ta gc        tg cg       |  g cg       |  a       tt gt       |  a      c  g at       |  a       gt t  |      |  a       tg a  |      g  a       gc c  |      g  a       gc c  |       cg        cg t  |       cg        gc gt        gc        gc at       g  g       at at        tg        at cg        at        at gc       g  |       at ta        cg        at at        gc        at                         atgattttttccagggGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tepidum_TLS                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.00 kcal/mol Antiterminator: Size=46 nt.     Delta G=-10.90 kcal/mol Anti-antiterminator:   Size=42 nt.     Delta G=-13.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGTTTATGGCGTGATGTACAAGAATATCGTTTTGAAAAGTGAAATGGGCAGCATCTCC ACGAAAGCGGCAAGCATCGAGGAAAACGTCGTCGGTTCGGCGTCGAAATTCGCGATTC CGGCGCGCCACACCGTTCAGGAGGTCAATGTTGCCGAGGAGATGGAGAAAGCCGCAAA TGGTGGGTCAGGAGAGTAAcgtcaccatgcaagtccatagccggtaacgcgatggccggtttttgcattacagcgaaaggaaaaaa ggcggtgcttgtgccgccttttttatgattttttccagggGTG     CT1619 Gene: CT1619     GI: 21674437     BI number: CT1619     GOG: -------     Description: hypothetical protei            tt           a  a   c       c  c g  g       ga c  a       tg a  t       tc a  g       tg tg        ta gc        ta gc        ga cg       |  g cg       |  g gt       |  a at       |  a t  |      |  a a  |      g  a       tt c  |      c  a      c  g c  |       ca        gt t  |       gg        tg gt        gg        gc at       t  c       gc at        ag        cg cg        gg        gc gc       c  |       gc ta        gt        at at        cg        at                         ttttatgattttttccagggGTG     ..................................................................................................................