                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:84 nt.    Distance to gene:26 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-17.60 kcal/mol
Antiterminator:    Distance from promoter:58 nt. Size=48 nt.     Delta G= -4.47 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatc-tacgtt. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatctacggagtagtgctttttatttacgttttattgaggttttcccgaaacggtctatgaagtttttctcgtcattgccagtcttttttttgggtaa
tttttcgctacatttggggcgcgtattttaaggctgaaaggcgtacgcgccgttttatcgttatataataataagttactttcATG

    CT1621 --- CT1620 Gene: CT1621     GI: 21674439     BI number: CT1621     GOG: -------     Description: hypothetical protein Gene: CT1620     GI: 21674438     BI number: CT1620     GOG: -------     Description: hypothetical protei tt a  t c  g a  g tg cg gc        aa cg       g  a |  c       tg |  g       cg |  t       gc |  a      g  | t  t      a  | t  t      a  | t  t      t  | t  t      t  | t  a      t  | a  a       tg a  g       at tg        ta gc        gc gt        cg g  g       gc ta        cg ta        gc ta        gc             gttttatcgttatataataataagttactttcATG     ..................................................................................................................