Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCAGACTGCGGGGTCGAATTGCCGCCGCATCCTGCGAAAAGCAGGGCGGTGCAGAGC
GGGAGAATCCGGATGATGTGTGCTGGTCGCATgggtgaggtggttttattttcggtggaaagcttaccttgaaagg
tagggaatttttgtgtgagacgacagtggcgcgattgttgtggagtgtttgaagggtttgtcggatgttgctgtgtgcgtcttataatggactgaagatc
aaaaatccgcgtcttatgcggatcaatctaattaatgttgggtaccattaacaggagccgctctccATG

    CT1657 --- CT1656


Gene: CT1657     GI: 21674475     BI number: CT1657     GOG: NOG25771     Description: conserved hypothetical protein
Gene: CT1656     GI: 21674474     BI number: CT1656     GOG: -------     Description: hypothetical protei


 TG
G  C
T  T
G  G
 TG
 AT
 GC         t
 TG       t  c
A  C      t  g
G  A       tg
 GT        at
 Cg        tg
 Cg        tg
 Tg        ta
 At        ta
A  g      g  a
G  a      g  g
A  g      t  |       ga
G  g      g  |      t  a
G  t       gc        ta
G  g       at        cg
 Cg        gt        cg
 Gt        ta        at
 At        gc        ta
 Gt        gc        tg
 At        gt        cg
                        gaatttttgtgtgagacgacagtggcgcgattgttgtggagtgtttgaagggtttgtcggatgttgctgtgtgcgtcttataatggactgaagatcaaaaatccgcgtcttatgcggatcaatctaattaatgttgggtaccattaacaggagccgctctccATG


    ..................................................................................................................