Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGTCGATCAACTGAGCTTGTGGATCGCCGTAGCCATTTCCTTCGGCGGTGAGTCTG
TTTGGTTCATCGGAGATTGGATTACCAGCCATggagagcggctcctgttaatggtacccaacattaattagattga
tccgcataagacgcggatttttgatcttcagtccattataagacgcacacagcaacatccgacaaacccttcaaacactccacaacaatcgcgccactgt
cgtctcacacaaaaattccctacctttcaaggtaagctttccaccgaaaataaaaccacctcacccATG

    CT1658


Gene: CT1658     GI: 21674476     BI number: CT1658     GOG: -------     Description: hypothetical protei


           cc
          a  c
          t  a
          g  a
           gc
           ta
  c        at
g  g       at
a  g       ta
 gc        ta
 at       |  t
 gc        gt
 gc        ta
|  t       cg
T  g      |  a
A  t      |  t        a
C  t      |  t      a  g
C  a       cg       t  a
G  a       ta       a  c
 At       c  t       cg
 Cg        gc        gc
 Cg        gc        cg
 At        cg        cg
 Ta        gc        ta
                        tttttgatcttcagtccattataagacgcacacagcaacatccgacaaacccttcaaacactccacaacaatcgcgccactgtcgtctcacacaaaaattccctacctttcaaggtaagctttccaccgaaaataaaaccacctcacccATG
    ..................................................................................................................