                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.80 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGGTTACCGGCACCGGTTCGGCGTGCAAGGAGCAGGTGGCGGCAATGCTGTCGCGG
ATGCTCGAGCTTGGCGGTGAGCTGAAGCCTCTCGATGTTACCGATGCGCTTGGCATCG
CCTACTGCGATCTCGCTCGGGGTGCATCTTCGCTCGGCGGCCAGTTGCGCAAGAACGG
AAAAGGGCGGAGCAAGGGATGGGCGGCGTTCGTAAACGAGCATCCCGAGCTGATGGCC
TGAttttttatcaacgagtggtgccggagtttggatttcggcatctgttttgtcaaacgatcctcaggATG

    CT1663 Gene: CT1663     GI: 21674481     BI number: CT1663     GOG: COG0558     Description: CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase, putativ             t           a  c           t  a           t  a           t  c   C        tg T  G       ta T  T       tg G  A       At C  A      G  | G  A       Tg GC        Cg CG       |  t G  A       Cg        tg G  G       Gc       t  g GC        Gc        ta TA        Tg        gt AT       A  g       at GC       G  |       gt GC        Ta        gc GC        Cg        cg A  G       Gt        cg A  A       At        gc CG        Gt        ta GC        Cg        gt AT        Cg        gc                         tgttttgtcaaacgatcctcaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0558 Phosphatidylglycerophosphate synthase ... can be seen here     ..................................................................................................................