                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-13.20 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-16.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGATCGTGCCGTTCGTGCAATCCTGGGCGTGGCCATGCTGTTGTACAGCATTGTTTT
CCAGAACCTTGTCGGCCTTGTCGGCCTGATTCCTATTGTCACGGCAATCATCGGTTAT
TGCCCGCTTTATGAGGTGCTCGGGGTTACCACCAACAAATATGCCGACTGAaactttcgtca
gccgctttttctgaccggaagagtccggcaggcgttcgatatttcggggagattgatttcgatctcccttttttgttcctcccgaaactgccgttcccgt
tatctccttgttctaccggctcTTG

    CT1684 --- CT1683 Gene: CT1684     GI: 21674502     BI number: CT1684     GOG: -------     Description: hypothetical protein Gene: CT1683     GI: 21674501     BI number: CT1683     GOG: COG0474     Description: proton transporting ATPase, E1-E2 famil   t c  t g  t c  t c  t gc at cg        gg ta       a  c |  c       cg gc        gt cg       g  t tg       c  c ta        cg ta        ta cg        gt a  |      a  a a  |      g  |       tt A  |       at       a  t G  |       at        gc Ta        gt        tg Cg        gc        ta At        cg        at |  c       cg        gc Gc       a  g       at Cg       g  g       gc Cg        ta        gc Gc        cg        gc Ta        ta        gt                         tttttgttcctcccgaaactgccgttcccgttatctccttgttctaccggctcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0474 Cation transport ATPase ... can be seen here     ..................................................................................................................