                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atcgggattgtagatttaggcagaacacactgaaaaacccgttagtacctcgtcaaaccaagggagttaactattcagcatgcccgcaggtaactgcttt
cgttacagactttataaaatatacaaaaagatcgttcaacgccagcgccctgctacccgccccttggctcatcagggagtgaacggaatatagcccctca
ttatggcgcggaacgtcccgccttttctgaaaagccaaaacttgatttcacttctctatcacccggaatccagcttcagccggctccaaaaaggtgcaca
TTG

    CT1686 Gene: CT1686     GI: 21674504     BI number: CT1686     GOG: -------     Description: hypothetical protei ct c  t cg cg gc c  t c  c       ga c  a      g  a a  t      c  t t  |      a  a c  |      a  t gc       g  a ta        tg cg        gc cg       a  | cg        gc g  a       gc c  g       gc g  |       at a  |      |  c c  |      |  a        c c  |      |  t      a  g g  |      c  t      a  t c  |       ta        gc a  |       at        gc at        cg       c  | cg        tg        gc ta       |  c       cg ta        cg        gc gc        gc        gc                         ttttctgaaaagccaaaacttgatttcacttctctatcacccggaatccagcttcagccggctccaaaaaggtgcacaTTG     ..................................................................................................................