Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-12.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATCGACGAAATAACCGAGGGCGGCCACGATGACCGGAAGACTGAAAACATCGCGAA
TGCTCGCGCGGGATGAgtcctgcatgggaaaaagggataaacaattgacgaaacagaacggaaaataaaaccttttccgggatatcat
tcgatgtcagaacatccggcaatcgactgaataataccgtttcatcccaaagatggcggttccggcttcggctaaccaaacgcaacgccgttttgttaac
gccccgtataaattgttataaaaaaatatagattgtatttagtattcatgcacgATG

    CT1694 --- CT1695


Gene: CT1694     GI: 21674512     BI number: CT1694     GOG: -------     Description: hypothetical protein
Gene: CT1695     GI: 21674513     BI number: CT1695     GOG: COG0642     Description: sensor histidine kinase/response regulato


  c
a  a
 at
 gc
a  c
 cg
 tg
 gc
|  a        a
 ta       c  a
 at       c  a
 gc        cg        tc
 cg        ta       t  g
 ta        at        cg
t  c       cg        gc
 at       t  |       gt
 cg       t  |      c  |
 ta        tg       c  |
|  a       gc        ta
|  t       cg        ta
|  a       cg        gc
|  a       at        gc
|  t      t  t      |  a
|  a      a  c      |  a
|  c      a  |      |  a
|  c      t  |      |  c
|  g      a  |      |  g
|  t      a  |      |  c
|  t       gc       |  a
|  t       tg       |  a
a  c       cg       |  c
 ta       |  c       cg
 at       |  t       gc
 gc        at        gc
 gc        gc        tg
 gc        cg        at
                        tttgttaacgccccgtataaattgttataaaaaaatatagattgtatttagtattcatgcacgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG0642 Signal transduction histidine kinase ... can be seen here

    ..................................................................................................................