                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-25.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGTTTCTCGGCCAGGCGATCAGGCGCACCGGCGAGGAGACGCCACCGCCGTCGGAAC
GGCTCCTGGCCACCATCAGCGCCAACACCATCGCGCTCATGAACGGCGCAGATATCCT
GCGCGTGCACGACGTCGATGCCGCCATCCAGGCTCGCGCCGTTGTGCTCGCAACCCGC
CGCGCTTCGGACTGAtcggcgtcaacgctccgttgtctggttcgtcgatttttttgttaactttcgcccgacagcgacgttcgctcgga
cgccgtcgctctttcggagaccgttaataccccgttcATG

    CT1707 --- CT1708 --- nusB --- nth Gene: CT1707     GI: 21674524     BI number: CT1707     GOG: COG1196     Description: Smc family protein Gene: CT1708     GI: 21674525     BI number: CT1708     GOG: COG0546     Description: hydrolase, haloacid dehalogenase-like family Gene: nusB     GI: 21674526     BI number: CT1709     GOG: COG0781     Description: N utilization substance protein B Gene: nth     GI: 21674527     BI number: CT1710     GOG: COG0177     Description: endonuclease II AT C  C       CG C  C      G  C G  A      C  T        t CG       C  T      c  c CG        GC        gc GC        CG        cg |  T       CG        at T  C      C  A       at A  G      A  C       cg GC        AT       |  t CG        CG       |  c T  C      |  A      |  t GC       G  t      |  g CG       C  c      |  g AT        Tg       |  t GT        Cg       t  t CG        Gc        gc AT        Tg        cg CG       |  t       gt GC        Gc        gc T  T       Ta        cg GC        Ta        ta CG        Gc        At GC        Cg        Gt                         tttttgttaactttcgcccgacagcgacgttcgctcggacgccgtcgctctttcggagaccgttaataccccgttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG1196 Chromosome segregation ATPases ... can be seen here [R] COG0546 Predicted phosphatases ... can be seen here [K] COG0781 Transcription termination factor ... can be seen here [L] COG0177 Predicted EndoIII-related endonuclease ... can be seen here     ..................................................................................................................