                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-14.20 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G= -9.89 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGAGGTGGATCGCCTTGCGCGCGAACTCGTAACGGAAATCGAGATGGTCGGAATCCG
TTTCGACTTTTGCGGTTTTAAACATTCGATCCATtacgcgtagtgtcctgacgtgttactcatcatgcagccggt
aaaaaatgacgtgctgaatatacaccgaaaattccggatgtggaaaagagagcaggccaatcgagggcgcgagaaattcgtccatgaacacctggctgaa
gggggttcgttttttggtgaaatcgcttattttattcacagaagtttccgttatcaggttcaagcgcATG

    CT1713 --- CT1712 Gene: CT1713     GI: 21674530     BI number: CT1713     GOG: COG0248     Description: exopolyphosphatase, putative Gene: CT1712     GI: 21674529     BI number: CT1712     GOG: COG0115,COG0147     Description: para-aminobenzoate synthetase, putativ   a a  t a  t a  c gc cg cg |  a at cg at tg |  g |  a |  a |  a |  a       aa |  g      g  a |  a       at |  g       gt |  a      c  | |  g       gc |  c       cg |  a       gt |  g       gc |  g       gc |  c      a  a |  c       gt        ct |  a       cg       g  g |  a       ta       g  a a  t      a  a       ta t  c      a  c       cg a  g      c  a       cg a  a      c  |      |  g g  g       gc       a  g tg        gc        cg cg        at        at gc       |  g       at tg        cg        gc gc        gc        tg cg        at        at                         tttttggtgaaatcgcttattttattcacagaagtttccgttatcaggttcaagcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [FP] COG0248 Exopolyphosphatase ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here     ..................................................................................................................