                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:147 nt. Size=33 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:    Distance from promoter:125 nt.    Size=40 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TATTAA. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAATATCATCACGTGATTTCGTATTAAATGTTATGGCCGATATATCGATCTGAcc
aaacaccatttggggattaagaacggtgcgcatgacaaagcataagcgatcctgagcaaatagccaccacaggcttatctttcagcaccttccttccgtt
caactgtcacagccacaagcacttgtttcaaaagaacctcttattgacagtggtcaatgatttgttgtccctttctgcctataatagcttcatgtaagac
agaATG

    CT1717 Gene: CT1717     GI: 21674533     BI number: CT1717     GOG: COG2191     Description: tungsten formylmethanofuran dehydrogenase, subunit E, putativ   c a  a c  a cg gc         c |  a      a  c |  c      a  t |  t       gc at        at cg        at at       a  a c  t      a  t t  t      c  t       gt gc       t  |      a  g ta        tg        cg c  a       ta        at a  a       gc        gc a  a      t  |       ta cg        ta        ta ta        cg        at ta        at        tg gc        cg        ta                         tttgttgtccctttctgcctataatagcttcatgtaagacagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2191 Formylmethanofuran dehydrogenase subunit E ... can be seen here     ..................................................................................................................