Gene putatively regulated by attenuation in C_tepidum_TLS
Characteristics of the secondary structures
Terminator: Distance from promoter:71 nt. Distance to gene:39 nt. Distance to run of Ts=0 nt. Size=36 nt. Delta G=-14.80 kcal/mol
Antiterminator: Distance from promoter:57 nt. Size=31 nt. Delta G= -5.40 kcal/mol
Anti-antiterminator: Distance from promoter:30 nt. Size=43 nt. Delta G= -8.30 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttaagg-ttaaat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttaaggtgattagtgtactttgcttaaatagataaggttttttcctgttttgattatactcaggggattgtgcgattctccaacagactcgatgttttgt
gatggccatgcatcagtgcaaatgcgcgtggtcatttttcttgaattgcgttgtattgaaaaataataacgataaaagcATG
CT1734
Gene: CT1734 GI: 21674549 BI number: CT1734 GOG: ------- Description: cytochrome c, putativ
a
c a
c c aa
ta a t
cg cg
ta g gc
t c t g t |
at a c g |
gc gc a |
cg ta c |
g a gt t |
t t t | a |
g | t | cg
t | t | gc
tg tg tg
at gc at
gt ta cg
gt at cg
gt gc gt
g g c | gc
at ta ta
cg cg at
ta at gt
tttcttgaattgcgttgtattgaaaaataataacgataaaagcATG
..................................................................................................................