Gene putatively regulated by attenuation in C_tepidum_TLS
Characteristics of the secondary structures
Terminator: Distance from promoter:60 nt. Distance to gene:150 nt. Distance to run of Ts=0 nt. Size=23 nt. Delta G= -7.00 kcal/mol
Antiterminator: Distance from promoter:36 nt. Size=35 nt. Delta G=-14.00 kcal/mol
Anti-antiterminator: Distance from promoter:2 nt. Size=52 nt. Delta G= -8.54 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgatt-taaact. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgattgatgctgttacaaacacagtaaactctcttcaaacaggtcgttaacgctgaaaaagtttccttcagacatggtttgcggagagagaccgtgctg
aaaattcaagcggttttttgaggcgagtgcgacaatttcgccgatatgacgttgccgcttacgtcataaataactacattaacctatgcgataccccaaa
ttttcgcatatatacccctcccgttcgggaacccctataccccttcaatccaaacggagaaaaaaatcATG
CT1750
Gene: CT1750 GI: 21674565 BI number: CT1750 GOG: ------- Description: hypothetical protei
a
a a
g a
ta
cg
gt
| t
| t
c c
a c
a t ga
t t g g
t c c a
g a g g
cg ta
ta tg
gc ta aa
| a gc a t
g t gc at
a g tg gc
cg at ta
at cg c a
at a | g |
at gc tg
cg at gc
t c cg cg
tg ta cg
cg ta at
tttttgaggcgagtgcgacaatttcgccgatatgacgttgccgcttacgtcataaataactacattaacctatgcgataccccaaattttcgcatatatacccctcccgttcgggaacccctataccccttcaatccaaacggagaaaaaaatcATG
..................................................................................................................