                                                                        Gene putatively regulated by attenuation in C_tepidum_TLS

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -5.65 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCATCGACCTCTCGAAAGCTGCAGCCAAACAGCTCGACCTTGTTGACAGTGGCGTC
GGCAGAGTCAAGATAGAAGCGTATAACTAActctcacatcaggctttcataaactccctcagtttgttcaggcaatcg
aaggttttcgattgcctgttttttttatctgaggattttcatcgattccgcttatccccttctattcgttacacgcccgtaaatcgttcagaaaagcttg
tcgttctcccaacaatagtgtaattaggtgcggttttttcccaactcttttcccaagaaaaattATG

   ف Gene: CT2078     GI: 21674888     BI number: CT2078     GOG: COG0446     Description: NADH oxidase, putativ ct A  c A  t T  c C  a A  c A  a T  t A  c T  a G  g Cg Gc At At G  t        c A  c      c  t Ta       c  c       gt At        ta       g  t G  a       cg        at A  a       at        at A  |       at        gc C  |       at        cg Ta        tg        ta Gc        at        at At       c  t       at Gc       t  c       cg A  |       ta        gc C  |       tg        gc Gc        cg        at Gc        gc        cg                         ttttttttatctgaggattttcatcgattccgcttatccccttctattcgttacacgcccgtaaatcgttcagaaaagcttgtcgttctcccaacaatagtgtaattaggtgcggttttttcccaactcttttcccaagaaaaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0446 Uncharacterized NAD(FAD)-dependent dehydrogenases ... can be seen here     ..................................................................................................................