Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGTTTCCCAGGTTGCGGGTGGCGATATTGGCCATGCCGGCAGCCGTGGTGACATCCC
AGAAGCTGTTGCTCAGCTGGATGGCTTTTTTGATATTGGTGTATTGATGCATcgtgtatag
ccccgtcttgtgttgattgaaacgatttgcgcttcccgcgccgctgtctgcgcagcggctgcgaaaaggccctgccgcgcgagctggactccggcggcat
atagactgttcttatattgattaaaaatattatgccacataatactattctaaatgcatagtatcagcatgtaagcgcgaaTTG

    CV0022


Gene: CV0022     GI: 34495477     BI number: CV0022     GOG: -------     Description: hypothetical protei


            C
          A  A
          G  T
          T  C        G
           GC       T  C
           GC       T  T
           TA        GC
          |  G       TA
  A       G  A       CG
C  G      C  A       GC
 GC        CG        AT
 GC        GC       |  G
 CG        AT       A  G
G  T       CG       G  A
T  G       GT        AT
 TG        GT        CG
 aT        CG        CG
                        CTTTTTTGATATTGGTGTATTGATGCATcgtgtatagccccgtcttgtgttgattgaaacgatttgcgcttcccgcgccgctgtctgcgcagcggctgcgaaaaggccctgccgcgcgagctggactccggcggcatatagactgttcttatattgattaaaaatattatgccacataatactattctaaatgcatagtatcagcatgtaagcgcgaaTTG
    ..................................................................................................................