                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:125 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-17.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGGAGGACACCCATGTCCCACCCCACAGCTTACCCGGCACAAAGTTCGCGCATCCT
ATGCAACCCACAACAGGGCGGTCCCAAGTCTTGCTGTGTTCAAACAGGCTACGGAGGC
CTACCTGGTTCTAATAGGAGCTTTCAAGCTGCCGATTGAactgcgctccctgtcttttagtgcacatccgc
tcatttcctgtcaaagccggcttgttgtcgcgtccgcaacgtcaatagaatcctaatctccttcccactcaatgacataccttctccagaaggtatcttc
gcctggaacgccgATG

    CV0023 --- CV0024 --- CV0025 Gene: CV0023     GI: 34495478     BI number: CV0023     GOG: COG3501     Description: probable vgr related protein Gene: CV0024     GI: 34495479     BI number: CV0024     GOG: NOG41501     Description: probable hydroxyethylthiazole kinase Gene: CV0025     GI: 34495480     BI number: CV0025     GOG: -------     Description: hypothetical protei TC T  A G  A TA GC TA CG         C G  |      T  T T  |      T  A T  |      G  A C  |       GT TG        TA        GC GC        CG       T  C AT        CG       C  G |  A      A  A      G  A A  C      T  |       AT CG       C  |       AT CG        CG        CG |  A       GC        TA CG        GT        Ta TG        AT       |  c GC        GT       |  t GC        GC       |  g C  T      C  A      T  c G  A      A  |       Cg GC        TA        Gc GC        CG        At AT        GC        Gc CG        GT        Gc                         ctgtcttttagtgcacatccgctcatttcctgtcaaagccggcttgttgtcgcgtccgcaacgtcaatagaatcctaatctccttcccactcaatgacataccttctccagaaggtatcttcgcctggaacgccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3501 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................