                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=23 nt.     Delta G=-16.40 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGCGGCGCAGCGCGTCGGTCGCCATCAGCAGGGAAATGATCGCGCCGGCGTCGCGC
AGGTCGGCGCGGATGCAGAGCGCGGCGGCTGGCGCGCCGGTTTCCGCCGTGGCGTGCA
CTTCGCCGCCGGGAAAGGTGAAGAGGTCCAGCTTCAGCGCCTGCGGCTGGCCATCGCG
GGTGAGGTAGCTGACGGTGATCATcgcggtatcctttatgagtgccgctggccttgctggctggcggtgcggtcggctctta
gttggttatttcgactaacatgggcgcagtatatccatgcttagTTG

    CV0032 Gene: CV0032     GI: 34495487     BI number: CV0032     GOG: COG1051     Description: probable MutT/nudix family protei   a t  t gc gc c  t g  t c  t Ta At Cg Ta                  gg A  g                c  t G  t                g  g Tg                  gc Gc                  tg Gc                  cg C  |                 gt A  |                 gc G  |                 tg T  |        g        cg Cg       t  c       gc Gc       t  t      |  t At        cg       |  c |  g       cg       t  t Tg        gc       t  t Gc       g  t      c  a Gc       t  g       cg At        cg        gt Gt        gc        gt Tg        cg        tg Gc        cg        cg                         ttatttcgactaacatgggcgcagtatatccatgcttagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG1051 ADP-ribose pyrophosphatase ... can be seen here     ..................................................................................................................