                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=3 nt.   Size=15 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-14.20 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCCCGGCGCTGGACATGGACCAGCGAGTGTGAgcgcgcgggcatcttgtaattaaagtacatccaggcctgtt
gcgggggcgcccgaacggcggccccgtccggcaggctccgcgtcgaagccggcgggaaaatccgcccgatgtccttgcgccgcaaggctgcttctctttt
gctggtttgccaacagtacagatgccaacggcttggcggcctgtagcttagccgctacaatgcgcgcggccggcgaccgccccgatattgcatggcggcg
ccgggttcatcaggaaaaccgccccATG

    CV0045 Gene: CV0045     GI: 34495500     BI number: CV0045     GOG: COG3491     Description: probable oxidoreductase iron/ascorbate famil            aa           a  a           g  t            gc            gc            cg   g        gc c  t       gc gc       |  c cg       c  g c  a      c  a ta       g  t cg       a  g gc        at        ca gc        gc       g  a a  g      c  c       cg cg       t  t       cg gc        gt        gc g  g       cg       |  t cg        gc        cg cg        cg        gc                         ttctcttttgctggtttgccaacagtacagatgccaacggcttggcggcctgtagcttagccgctacaatgcgcgcggccggcgaccgccccgatattgcatggcggcgccgggttcatcaggaaaaccgccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3491 Isopenicillin N synthase and related dioxygenases ... can be seen here     ..................................................................................................................