                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.94 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGAACTGCCCAAGGTGCGCGCCTTCCGCGACTGGCTGGTGCACACCGTCGCCAACAG
CGAGGAAGCGAGCTGGCTGGCGCGCCAGGGCTACTGAgcggcgcaggcgtccggggacgcgcttttgcgcggc
cccgttccctttttcccgacaacatttgttaaccgcgggcgcgtggcgcggcggtttcttccgccgcataatgattgatatagcaactattgactgatca
atcatgaatgctcccgatgcttcccggttccggcccgacgcgctggatttccgccagcggctgatggcgATG

    CV0048 --- CV0047 Gene: CV0048     GI: 34495503     BI number: CV0048     GOG: COG0477     Description: probable transport transmembrane protein Gene: CV0047     GI: 34495502     BI number: CV0047     GOG: COG1846     Description: probable transcriptional regulator, MarR famil             a           c  t            at            at            cg            at            gt           c  a           c  a           c  c           t  c           t  g tt       t  c t  t      t  |        t cg       t  |      g  g gc        cg        cg cg        cg        gc gc        cg        cg cg       t  c       gc a  g       tg       g  g gc        gc       g  | gc        cg        cg gc       |  t       gc gc        cg        cg cg        cg        cg                         tttcttccgccgcataatgattgatatagcaactattgactgatcaatcatgaatgctcccgatgcttcccggttccggcccgacgcgctggatttccgccagcggctgatggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................