                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-25.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGACGGCTGCCTGGGCTTCCACGCCCAGGCATTGGTCAAGCTGGGCGCCAGCAAGAC
GGAAGTGGAAGAAGCGCTGGCGATGGCGGTCTACATGGGCGGCGGCCCGTCGCTGATG
TATTCCGCCCACGCTTTGGCCGCCTTCGAGCAGTTCAGCGCCAAGACCGCCTAGtctcgc
atcgtccgctgtgggacaattcttcatggccgggcgcaagcccggctatgctttttgaaccaccgcctggatttcacgcaccatgtctgccagctccctg
cgcgcgctgtcgctcatcccgccgATG

    CV0086 Gene: CV0086     GI: 34495541     BI number: CV0086     GOG: COG1032     Description: conserved hypothetical protei            aa           c  t            at            gc           |  t            gt        ca tc        gc       g  a g  c       ta        cg c  g       gt        gc t  c       tg        gc at        cg        gc cg       |  c       cg gt        gc        cg cg        cg        gc tg        cg        gt cg        tg        ta ta        gc        at Gc        cg        cg                         ctttttgaaccaccgcctggatttcacgcaccatgtctgccagctccctgcgcgcgctgtcgctcatcccgccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1032 Fe-S oxidoreductase ... can be seen here     ..................................................................................................................