                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.47 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACGTCCGACCGGTGGAAGCTGGCCACCAGTTCCTGCACCACCTTGGGAACCATGG
GCAGCTTGCCCGAGGCCTTGTCGAAGATTTCCCCCACCTGCATcgatgctctccccttgccggtttag
caggtttgagcttaggcaatccggaggggaatgagaaactccgcttggcggcggcaagtcgctgagacgcaaggctatcctttcattttcatttttgcgc
tggctcaggatgcgggctatttttcagcgagaggggcctgcgaatgtccgggttcgaacttgcggaggcgcaagATG

    CV0095 Gene: CV0095     GI: 34495550     BI number: CV0095     GOG: COG0840     Description: probable methyl-accepting chemotaxis transduce            tc           t  a           t  t           c  t           c  t           t  t           a  c           t  a           c  t            gt            gt            at            at   c        cg g  a       gc g  a       cg         g cg       |  c      a  g gt       |  t      c  a gc       |  g      t  t cg       a  g       cg gc        gc        gc g  t       at       g  g t  g       gc        tg ta        ta        cg cg        cg        gc                         tatttttcagcgagaggggcctgcgaatgtccgggttcgaacttgcggaggcgcaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................