                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcgtggcggcaggggcgcgaatcgattaaaatcgtctgatcagccaccATGGAGGGTACGATGTACCAGTCCGAATTC
ACCCAGTTCATCAACGGCTTCCTGGAAAAGAATCCGGAAGTGGACAGCGAGCGCCGCG
AACTGCGCCTGACGCTGTGGGACCGCGAGCTCAACCTGGACGACCAGCGCCGCTGGAA
GGAATCCAGCGTGCCGCAGAAGCCCTACGTGTACCAGCCGGAATAAaccgaaccggtccgcctccg
acgcccttcgcgggcgttttgtcattttgaaagcccgaacATG

    CV0106 Gene: CV0106     GI: 34495561     BI number: CV0106     GOG: COG4122     Description: probable O-methyltransferas GA A  A        a CG       a  c GC        gc C  C       cg C  C       cg GT       a  | TA       A  | GC       A  | CG       T  | GT       A  | A  G       At C  T       Gc C  A       Gc        cc T  |       Cg       g  c A  |      C  c      c  t A  |       Gc        at GC        At        gc GC       C  c       cg A  A      C  c      c  c A  G      A  g       tg GC        Ta        cg GC        Gc        cg TG        Tg        gc CG        Gc        cg                         ttttgtcattttgaaagcccgaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4122 Predicted O-methyltransferase ... can be seen here     ..................................................................................................................