                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-20.00 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-23.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGTGGACCTCGCCGATCTGCCGCTGGCCAAGCTGCGCGAATTCTCGGCGCTGATCG
AGGACGATGTGTTCGGCGTGCTGACGCCGGAGGGCAGCCTGGCGCAGCGCGACCATGT
CGGCGGCACCGCGCCGGCGCAGGTGAGGGCGCAGATCGCCCGCCACCGCGGCCGTCTG
GGCTGAgcctcccggctcgcgcgcgaaccctcctgcgggagggtttattttttggtttaaaataagataattatttaaaaccaatcatcaattccg
catgggcggaattgcacgcgcggagagtcgATG

    CV0114 --- CV0113 Gene: CV0114     GI: 34495569     BI number: CV0114     GOG: COG2200     Description: conserved hypothetical protein Gene: CV0113     GI: 34495568     BI number: CV0113     GOG: COG1794     Description: probable aspartate/glutamate racemace protei AC C  C CG        cc GC       t  c CG        cg CG        cg C  C       gc GC        At CG        Gc T  |       Tg AT       |  c GC        Cg AT        Gc CG       G  g G  G       Gc CG        Tg GC       C  a |  T       Ta        gc |  G       Gc       t  g |  A      |  c       cg |  g      |  c       cg Gc       C  t       ta Gc       C  c       cg At        Gc        cg Gc        Gt        cg T  |       Cg        at Gc        Gc        at Gc        Cg        gt                         attttttggtttaaaataagataattatttaaaaccaatcatcaattccgcatgggcggaattgcacgcgcggagagtcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2200 FOG: EAL domain ... can be seen here [M] COG1794 Aspartate racemase ... can be seen here     ..................................................................................................................