Gene putatively regulated by attenuation in C_violaceum
Characteristics of the secondary structures
Terminator: Distance from promoter:105 nt. Distance to gene:79 nt. Distance to run of Ts=0 nt. Size=24 nt. Delta G= -6.00 kcal/mol
Antiterminator: Distance from promoter:68 nt. Size=48 nt. Delta G= -7.32 kcal/mol
Anti-antiterminator: Distance from promoter:40 nt. Size=47 nt. Delta G=-34.90 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGCAC-taaaat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGCACTAAATACAAGCAGCTAAtattaaaatcattaggaacgcaaagggtcgtagattaagatgccgatttaggaccgtagg
ttgggcttcattttattcagcccaacctacggtcctcattgtctaaccggacgttatccggcatgcctgcgccgtgtgttatttcatttttgccctgttt
ttccactctgtcgtaagccgtttaactcaaacgttagtattcaattggtacaggagaggtcATG
CV0140
Gene: CV0140 GI: 34495595 BI number: CV0140 GOG: ------- Description: hypothetical protei
t
g c
t t t
t t t a
t a a a
a t c c
c t t c
t c cg
ta cg
cg ta
gc g |
gc gc
gc cg
ta at
ta t t cc
gc c a g t
gc c t t g
at a c a c
ta a c cg
gc c | gc
cg cg gc
cg cg cg
at gc c t
gc | a t g
gc at at
at cg tg
ttatttcatttttgccctgtttttccactctgtcgtaagccgtttaactcaaacgttagtattcaattggtacaggagaggtcATG
..................................................................................................................