                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-23.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-19.40 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G=-11.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCCTGGAGTTCCTGGAAGGCAAGGAGCTGCCGGCGGTGGCCATCCTGGCCGAGCGCG
CGCAGTAAgcgacagggccatgctggcttgccggcatggccttttttccgcatcgggccgaggacaaggcaagcgccatcggggataatgccgg
ccttgtccgccacgccggacacgcaggacgaaagccggcgcggcggccccggcggctgcgccgtttcggcaaatcgcggcgcgcggcgggcgataagcgt
aagattggaaacaggaaaacggatacccgcggaaactgaggagaagagATG

    CV0188 Gene: CV0188     GI: 34495643     BI number: CV0188     GOG: COG1280     Description: probable homoserine/homoserine lactone efflux protei             G           A  T           C  A           G  A            Cg            Gc            Cg           G  a           C  c           G  a           A  g           G  |       tt   C        Cg       c  g T  C       Cg        gc A  T       Gc        gc CG        Gc        tg CG        Ta        cg GC       C  t       gc GC       C  g       ta TG       T  c       at |  A       At        cg G  G       Cg        cg GC        Cg        gc CG        Gc        gc GC        Gt        gt                         tttttccgcatcgggccgaggacaaggcaagcgccatcggggataatgccggccttgtccgccacgccggacacgcaggacgaaagccggcgcggcggccccggcggctgcgccgtttcggcaaatcgcggcgcgcggcgggcgataagcgtaagattggaaacaggaaaacggatacccgcggaaactgaggagaagagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1280 Putative threonine efflux protein ... can be seen here     ..................................................................................................................