                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-15.00 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-15.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCAGCAGAGCGTGCTGCCGGCTGGCCTGCCGCGCGTGGCGGTGGAGGCCGGCCATCC
GGACTTCTGGCGCAAGTACGTCGGCCTGGAAGGCGACGTGGTCGGCATCGACCACTTC
GGCGAATCCGCGCCGGCCGGCCAGCTGTTCAAGGAATTCGGCTTCACCGTGGAAAACG
TGGTCGCCAAGATCCGCGCCGTTCTGCGTTAAgacgtaaacagaccaccggggcggctcggtggtctttttttgcc
gtgtcgtgtagtgccggcactacattcagtaccctggagaagagagaagcATG

    CV0190 Gene: CV0190     GI: 34495645     BI number: CV0190     GOG: COG0057     Description: probable glyceraldehyde 3-phosphate dehydrogenas            AA           T  g            Ta            Gc   C        Cg C  A      |  t G  A      |  a CG       |  a TA       |  a |  T       Gc GC        Ta GC        Cg TG        Ta        cg GC       |  c      g  g CG       |  c       gc |  C      |  a       gt A  C      T  c       gc A  G       Gc        cg AT        Cg        cg AT        Cg        at GC       G  g       cg G  T       Cg        cg T  G       Gc        at GC        Cg        gc CG        Cg        at                         ttttttgccgtgtcgtgtagtgccggcactacattcagtaccctggagaagagagaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0057 Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase ... can be seen here     ..................................................................................................................