Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-14.35 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAACCGCGCGCCGCCTGACCCTGGTGTGGGGCGTGGTCGCCTACCACGGCCCGGACGC
CGAGAACCTGGAAGACATGGTGGTGAAGACCACCTTCTGCGCCACCAAGCTCAGCCTG
GCCGAGCAGGGCAAGCCGATGGTGATCATCGCCGGCGTGCCCTTCGGCACCCCCGGCT
CCACCAACCTGCTGCGCATCGTCTATCCATAAggcttggccggcatcgatacgacaacggaaccttcgggttccgt
tttttcttgtccgagcctccgcggtccgcgccggatactatgctgcaacaGTG

    CV0248


Gene: CV0248     GI: 34495703     BI number: CV0248     GOG: COG0834     Description: hypothetical protei


            C
          C  A
          T  T
          A  A
           TA
           Cg
           Tg
           Gc
          C  t
          T  t
          A  g
           Cg
           Gc
          C  |
           Gc
           Tg
           Cg
           Gc
           Ta
          C  t
 TT       C  c
C  C      A  g
 CG       A  a
 CG       C  t       tc
 GC       C  a      t  g
 TA       A  c       cg
 GC       C  g       cg
|  C      C  a       at
C  C      T  c       at
 GC       C  a       gc
 GC       G  a       gc
 CG        Gc        cg
 CG        Cg        at
 GC        Cg        at
                        ttttcttgtccgagcctccgcggtccgcgccggatactatgctgcaacaGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here

    ..................................................................................................................