Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=17 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.87 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCACCAGCATCGCCGCCAATGTCGAGCAGGTGGCGCAGATGTCGGAGGAAACCAGCG
CCGCCGCGACCCAGACCGCCGAGGCGGCCAGCCAGGTGGAGCAGATGGCCGGCGCGCT
GCAGTCGGCGATCAGCCGCTTCAGGCTCCCGGCAGGCGGCCAGCCGCAAAGCTCGGAC
AGAACCGCGCAGCCCTTGGCCGCGACCGCCTGGCAGGCTTGAgccggcgagttttccacagcaaggccc
cgccttgctcccgcaccttcctctctcgttctggcccgcctcgcgcgggcatctttcTTG

    CV0264


Gene: CV0264     GI: 34495719     BI number: CV0264     GOG: -------     Description: hypothetical protei


           cc
          t  c
           cg
           gc
           ta
          |  c
          |  c
          |  t
          |  t
          |  c
          |  c
          |  t
          |  c
          |  t
          |  c
          |  t
          |  c
          |  g
          |  t
          |  t
          |  c
          t  t
  c        cg
c  c       cg         c
 cg        gc       t  g
 gc       c  c      c  c
 gc       c  c       cg
 at       c  |       gc
 at        cg        cg
 cg        gc        cg
 gc        gc        cg
 at        at        gc
                        atctttcTTG


    ..................................................................................................................