                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-14.39 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGGGGTGAAGGGCGTGATGGGCCAGGTGCGCGCCGATCCGATGATCCTGAAGTCCGG
CGACGAGACCTACACGCTGAAGTTCGAATGCCGGCCTTGCGAGATGCACGTGATGGGC
AAGATGAAGAAGCACATTCTCAAATCCCCGCCGCCGAGCGAGATTCCGGCTTCGGCGC
CGATGACTTTCTTCAGGCAGCGGCCGTAGagctgctgtggtggcattaatttaatccagtattatgaaggcaagcttgt
atagcttgccttttttttgtcaattttctattggataaaggtttgatATG

    CV0267 Gene: CV0267     GI: 34495722     BI number: CV0267     GOG: -------     Description: hypothetical protei TA G  G C  a        t Cg       a  t Gc        at Gt        ta Cg        ta Gc        at At       c  | Cg        gc Gt        gc G  g       ta A  g      g  g C  |       gt T  |       ta T  |       gt         t C  |      |  t      g  a T  |      |  a      t  t T  |      |  t       ta T  |      |  g       cg C  |      |  a       gc A  |      |  a       at G  |       tg        at T  |       cg        cg A  |       gc        gc Gt       |  a       gc Cg        ta        at Cg        cg        at Gc        gc        gt                         tttttgtcaattttctattggataaaggtttgatATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.30 kcal/mol Antiterminator: Size=45 nt.     Delta G= -7.80 kcal/mol Anti-antiterminator:   Size=46 nt.     Delta G=-14.39 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGGGGGTGAAGGGCGTGATGGGCCAGGTGCGCGCCGATCCGATGATCCTGAAGTCCGG CGACGAGACCTACACGCTGAAGTTCGAATGCCGGCCTTGCGAGATGCACGTGATGGGC AAGATGAAGAAGCACATTCTCAAATCCCCGCCGCCGAGCGAGATTCCGGCTTCGGCGC CGATGACTTTCTTCAGGCAGCGGCCGTAGagctgctgtggtggcattaatttaatccagtattatgaaggcaagcttgt atagcttgccttttttttgtcaattttctattggataaaggtttgatATG     CV0267 Gene: CV0267     GI: 34495722     BI number: CV0267     GOG: -------     Description: hypothetical protei CG G  G A  C        t CC       a  t GG        at GT        ta AA        ta CG        at Ta       c  | Tg        gc Cc        gc T  t       ta T  g      g  g T  |       gt C  |       ta A  |       gt         t G  |      |  t      g  a T  |      |  a      t  t A  |      |  t       ta G  |      |  g       cg C  |      |  a       gc C  |      |  a       at G  |       tg        at C  |       cg        cg G  |       gc        gc Gc       |  a       gc Ct        ta        at Tg        cg        at Tt        gc        gt                         tttttgtcaattttctattggataaaggtttgatATG     ..................................................................................................................