                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggcctgacgcATGCAAACGTATCGATTCAACGTCTACGGCCATATCGTGGTGGCGGAGCGGC
ATGGCTCCGGCTGGCGGGCCTTTTTGCCCGACAACGACGGCAAGCGCCGGCCCGCCGA
TTTCGTCATTCCGGACTGGGTGACGGAAGACGGCCTGGCCCAGTATCTGGAAGACCTG
TTTCACGAGAACGCGACGCCGCGCAACGGCGATGTGACGCCGCTGGATTGAaaagcggctgc
gggcgcgaagccgcatgcgttggctttgccatgctggattgatcgcaatagggagaaacgATG

    CV0269 Gene: CV0269     GI: 34495724     BI number: CV0269     GOG: COG5331     Description: hypothetical protei             A           C  T           C  A            GT        CA            GC       G  T   T        CG       G  G A  T       AT        CG G  C       TG        GC C  A       CG        AT TA       T  |       GC GC        GT        GC TG        CG       |  G AT       |  G       CG gC       A  C       GC c  T      A  G       GT a  A       CG        TG a  C       TA       G  | a  G       TG       G  | g  G      A  |       TG a  |       GC        GC gC        CG        CG gC        TG        TG                         GCCTTTTTGCCCGACAACGACGGCAAGCGCCGGCCCGCCGATTTCGTCATTCCGGACTGGGTGACGGAAGACGGCCTGGCCCAGTATCTGGAAGACCTGTTTCACGAGAACGCGACGCCGCGCAACGGCGATGTGACGCCGCTGGATTGAaaagcggctgcgggcgcgaagccgcatgcgttggctttgccatgctggattgatcgcaatagggagaaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5331 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................