                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-24.80 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCATCCCAAGGTCGGTCCCAAGCCCAATTTCTGCGCCTATACCCGCGATAGCCGTCCG
CGTTTGAAATAAttcatttatcattgtcggcccgttggcccttcctgaaaccggcatgtccagagcgatgatgcgccgtcacggcagacgc
atgcggatgctaggcatcgacaacgcatcgtctgcgcgggcgatatcggcaaccgcgcggcctgcgaggccgcgttccacgtggaacgtcggatgccggc
cggcatccgctttttcatcttgaaggatggagaaatccggcggccgcgggaTTG

    CV0281 Gene: CV0281     GI: 34495736     BI number: CV0281     GOG: COG3238     Description: conserved hypothetical protei            cg           a  t            cg            cg            ta            ta            gc            cg           |  t            gc            cg            cg   c       g  a g  g      g  |       gc t  a      a  |      g  c cg        gt        cg cg        cg        cg gc        gc        gc gc       t  c       ta cg        cg        at gc        cg        gc cg        gc        gc gt        gc        cg                         ctttttcatcttgaaggatggagaaatccggcggccgcgggaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3238 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................