                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGTAGGAGACGTCGACGGTGGGCAGGTAGCCGGCGCGGCCGATGCCGGTCTCTTCGG
CCGACGAGCGGAATTCATGGAAGCGGAAGCGGACTTCCGGGTTGCTGACGATGGTTTT
TTCCACCACCGAACGTAGATCCGTTGCTTGCGACAGcgaggctgtcatgctcatcaatgcggcgagagtcagg
cgaacgctgcatttttgtaagcgtttcatggttaatcgtctccggatgcaaggggttgatattattaaatatttcaacaaatagattaaacaagtttgct
ttaaatggcaaGTG

    CV0309 --- CV0310 Gene: CV0309     GI: 34495764     BI number: CV0309     GOG: COG3672     Description: conserved hypothetical protein Gene: CV0310     GI: 34495765     BI number: CV0310     GOG: COG2199     Description: conserved hypothetical protei            tc         a   a       a  a      c  g g  g      c  a       tg cg       t  t       gc Gc        cg       a  g At        gc       g  a Cg        tg       a  a At       |  g       gc Gc       a  c       cg C  a       cg        gc G  t       ta        gt T  |      g  g       cg T  |       ta        gc Cg        cg        ta Gc        gt        at                         ttttgtaagcgtttcatggttaatcgtctccggatgcaaggggttgatattattaaatatttcaacaaatagattaaacaagtttgctttaaatggcaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3672 Predicted periplasmic protein ... can be seen here [T] COG2199 FOG: GGDEF domain ... can be seen here     ..................................................................................................................