                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:156 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-15.10 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-17.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGAGGAAGTGATGATCTACCGCCTGTTCTACACGCCGTCGGCGCTGGACATCAGCG
CGTCGCTGGAAACCGACTGGCGGCCGGGCGAGGTGTGGTAAgcgtttgattaggcaaatgaccggccccg
cggggccggtttttttatctccgcgcgcgttgcgcttgcggcgcaaagccttgccaggccaggctatgcctcagggatagcggtccgctatcgcgcttat
cctgaaatccaattggaattgccaggtgtcgcggcgcacagtgaggaagaatgaatcgcgaaggggatgccgATG

    CV0330 Gene: CV0330     GI: 34495785     BI number: CV0330     GOG: -------     Description: conserved hypothetical protei            ta           t  g           a  g   T        gc C  G       ta A  G       ta GC        ta CG        gt CG        cg A  |      g  | A  |      A  | A  |      A  | GC       T  | GC       G  | |  G      G  | TG       T  | CG       G  | GC        Ta CG        Gc TA        Gc        gc G  G      A  g      c  g CG       G  |       cg GT        Cg        cg CG        Gc        cg G  |       Gc        gc AT        Gc        gc CG       C  c       cg TG        Cg        cg AT        Gc        at                         ttttttatctccgcgcgcgttgcgcttgcggcgcaaagccttgccaggccaggctatgcctcagggatagcggtccgctatcgcgcttatcctgaaatccaattggaattgccaggtgtcgcggcgcacagtgaggaagaatgaatcgcgaaggggatgccgATG     ..................................................................................................................