                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-24.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTCGGTCAGCAGCGGCATCCCGCCCCAGCTACCGGCGCACCACAGCGCGATCACGG
CCAGCAACAGGGCGGACAGCAGGTTTCTCAGCAAGGGCAGGGGCATGACGGGTCTTAC
CGTGGGCAAACCCTTATCCTGCGAGTTTTTGCCGCGGCTGGCAACGGCCGCATGCGTG
AGATAAAGGTGGAAAATGCCATAAATCAAGGACGATCCGTCATTTTCTTGTTGTTTGT
ATGCCAAacgcttgttcggcgggcggtgtttgtttacgctgaaactttcctcaaggcgagaaacggcgATG

    CV0333 --- CV0334 --- CV0335 --- CV0336 Gene: CV0333     GI: 34495788     BI number: CV0333     GOG: COG0454     Description: conserved hypothetical protein Gene: CV0334     GI: 34495789     BI number: CV0334     GOG: -------     Description: conserved hypothetical protein Gene: CV0335     GI: 34495790     BI number: CV0335     GOG: COG2872     Description: probable alanyl-tRNA synthetase related protein Gene: CV0336     GI: 34495791     BI number: CV0336     GOG: COG0697     Description: conserved hypothetical protei            GG           A  A           A  C CA        CG G  A       TA GC        AT TG       A  C CG       A  C GC        TG GC        AT CG       C  | GC       C  | C  A       GC C  T       TA G  G       AT T  |       AT T  |       AT T  |       AT T  |       GC T  |       GT G  |      T  T A  |      G  G        t GC       G  |      g  t CG       A  |      t  c GT        AT        tg T  G       AT        cg C  A       TG        gc CG        AT        cg TA        GT       a  g AT        AT       A  g TA       |  G      A  c TA        GT        Cg C  A       TA        Cg CG        GT        Gt CG        CG        Tg AT        GC        At                         ttgtttacgctgaaactttcctcaaggcgagaaacggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here [R] COG2872 Predicted metal-dependent hydrolases related to alanyl-tRNA synthetase HxxxH domain ... can be seen here [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................