                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGCAGGCTTTGATAGATGAATTGGATGCCTTAGACCTGTCCGCACCGGATGCCGCG
TCCCGAATCTCCGCCATACGCTGGGACATGAAACCGCAGTAGccagccccaaaccagacttgccttgcg
taaaaccgcgctgacgcgcggttttaccatgcgtcccgccatcatgtcagcgctgacacccgtctactaaccccgctcgtcagcctcccgcacaataacc
gtcattctcaaacagcgacatccgtcatcggccctgcggccgatttttctttagccagcgggaggcgttttccATG

    CV0337 Gene: CV0337     GI: 34495792     BI number: CV0337     GOG: COG5301     Description: probable bacteriophge tail fiber protei ca t  t gc cg        tg cg       c  c t  c       cg a  c       cg c  c       gc a  |       gc gt        cg cg        ta gc        at             ttttctttagccagcgggaggcgttttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5301 Phage-related tail fibre protein ... can be seen here     ..................................................................................................................