                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-17.50 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCAGCCTGCCGTACATCTCGTCGCAGACGCCGCGTGCGGAATGCACCAACGCCGAC
GCCTACGTGTTCTGGGACAATCTGCATCCGACCACGCACACCCACGTGCTGCTGGGCC
AGATGGTGGCCGACTTCCTGCGCAAGCAGAACCTGAACCTGGCGGCGCAGGCGCGCCG
ACGCTGAgtctgacgccgcttgcggcgagacggaccgcatgccttgccggcatgcggttttttttatcctggcgggccggggcaggcgatctgct
atgctggccggagtgcgatgcggagcccgacATG

    CV0363 Gene: CV0363     GI: 34495818     BI number: CV0363     GOG: COG1073     Description: hypothetical protei            tt           c  g            gc            cg            cg CG        gc C  A       cg GC       |  a CG       |  g GC       a  a |  T       gc |  G       tg         g |  A       cg       t  c Cg        ta       t  c Gt        gc        cg Gc       |  c       cg At       A  g       gc Cg        Gc        ta |  a       Ta        at Gc       |  t       cg Cg        Cg        gc Gc        Gc        cg Gc       C  c       cg Cg        At        at Gc        Gt        gt Gt        Cg        gt                         tttttatcctggcgggccggggcaggcgatctgctatgctggccggagtgcgatgcggagcccgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1073 Hydrolases of the alpha/beta superfamily ... can be seen here     ..................................................................................................................