                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:178 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCGGCGACTTGCCGGTCGGCGAGTGGCGGCATCTGACGGCGGAAGAATTGGCTGCC
TTCGGCTTCTGAttgaatcggaaacccaaaaaaacggcgaagagcatgtctcctcgccgttttttcatgggcggccatgcgttttggcccc
ggacattgctggcgcgatcagtagcgtttgcgcgcaggtttccgtacatgcttgctatggcaggccaagaaaaatgcttgtccagttttcggttgtggag
gggaaagcccggcggacatactggcgcctgtattcaatacaggagccttccGTG

    CV0390 --- ADA Gene: CV0390     GI: 34495845     BI number: CV0390     GOG: COG2513     Description: conserved hypothetical protein Gene: ADA     GI: 34495846     BI number: CV0391     GOG: COG0350,COG2169     Description: methylated-DNA-[protein]-cysteine S-methyltransferas CG A  G GC TG CG TA |  A        g |  G      t  a |  A       ta |  A       At |  T       Gc |  T       Tg A  G       Cg CG        Ta GC        Ta GT       C  a CG        Gc GC        Gc GC       |  c T  |      |  a GT       |  a        t AT       |  a      a  g GC       |  a      c  t CG       |  a       gc |  G      |  a       at |  C      |  a       gc |  T      |  c      a  c |  T      |  g       at GC       |  g       gc GT       |  c       cg CG        Cg        gc TA        Ta        gc Gt        Ta        cg Gt        Cg        at                         tttttcatgggcggccatgcgttttggccccggacattgctggcgcgatcagtagcgtttgcgcgcaggtttccgtacatgcttgctatggcaggccaagaaaaatgcttgtccagttttcggttgtggaggggaaagcccggcggacatactggcgcctgtattcaatacaggagccttccGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2513 PEP phosphonomutase and related enzymes ... can be seen here [L] COG0350 Methylated DNA-protein cysteine methyltransferase ... can be seen here [F] COG2169 Adenosine deaminase ... can be seen here     ..................................................................................................................