                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=80 nt.     Delta G=-23.86 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGTTCCGGTCCCTTGCTGCGAAGTGGTGCCTGCATgcgcgctcccgcgttgaggttgttctgatggatgcca
ttgttccatttcctccccgcgcgagccggatgaccggtgtcagctcgatgtcagtgccgcatttactaacagcggctacaagaaacccaccccctccctg
ctgcattcttcgccacatccggcaagcgactcccgctggccggcagtccgagcgcggtttccgcgcgtctcttttcccctctgcttggagttccgctgtg
gcaagcacttcccagattgtcggcgcgCTG

    CV0407 --- CV0408 --- CV0409 --- CV0410 Gene: CV0407     GI: 34495862     BI number: CV0407     GOG: -------     Description: hypothetical protein Gene: CV0408     GI: 34495863     BI number: CV0408     GOG: NOG47495     Description: conserved hypothetical protein Gene: CV0409     GI: 34495864     BI number: CV0409     GOG: COG3497     Description: probable bacteriophage tail sheath protein Gene: CV0410     GI: 34495865     BI number: CV0410     GOG: COG3498     Description: probable bacteriophage tail core protei   t c  c a  c gc cg gc at a  g cg gc gc cg c  | t  | a  | c  | a  | c  | c  | g  | c  | t  | t  | c  | t  | t  | a  | cg gc ta cg gt t  c c  c c  | cg ta cg c  c c  g        t c  c      t  t c  |       gc a  |       gc c  |       cg cg        gc cg        cg at        gc at       |  g at        at gc        gc             tcttttcccctctgcttggagttccgctgtggcaagcacttcccagattgtcggcgcgCTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3497 Phage tail sheath protein FI ... can be seen here [R] COG3498 Phage tail tube protein FII ... can be seen here     ..................................................................................................................