                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-26.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-15.21 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGCCGTCGGCAACGTGCTGCAGGACGGCGACAGCGTCACCGTGATCAAGGACCTGA
AGGTCAAGGGTTCATCGCTGGTGGTCAAGGTCGGCACCAAGGTGAAGAACATCCGCCT
GGTGGACGGCGACCACGACATCGACTGCAAGATAGACGGCATCGGCGCGATGGGCCTG
AAGTCCGAATTCGTCAAGAAAGCCTGAtccggcatccgcgccggcaatcagcgaaggcggccctcgggccgcctttttcc
atcccgcctatactgaggcaacgccaccacgccaaacgccgcctcgATG

    CV0442 Gene: CV0442     GI: 34495897     BI number: CV0442     GOG: NOG29433     Description: hypothetical protei            cc           t  g           a  c            cg            gc            gc            cg            cg           |  c           |  a            ta            At            Gc            Ta            Cg           C  |   G       G  | T  A      A  | C  A      A  | CG       A  | GT       G  | GC       A  | GC       A  | TG       C  | |  A      T  | |  A       Gc |  T       Cg AT        Ta GC        Ta CG       A  | GT       A  | |  C      G  | |  A      C  | |  A       Cg |  G       Tg |  A       Gc |  A      A  | |  A      A  | CG       G  | GC       T  | GC        Cg        tc |  T       Cg       c  g CG        Gc        cg TA        Gc        cg At        Gc        gc C  |      T  |       gc Gc        At        cg Gc        Gc        gc Cg        Cg        gc                         tttttccatcccgcctatactgaggcaacgccaccacgccaaacgccgcctcgATG     ..................................................................................................................