                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-21.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGCTGCCCGCGGAATTCCGGGTAGCCGAAAATATGATTGAGGATGGAGACTGCGTC
GTGCATGACGGGACGGGGTAGCGCGGAGGAAAGCGCCATtgtacggcaaggcggctcccgggacgagccgg
gcaaaaaaatggccgccagatgatggcggcctcaagttggatggagacaatgtgaaacgaagaggaaaaatgctctcgcactacggaagaccgccgccgc
ggcgataaagttccggactttttgcaaaaatctgccacgccgccgcaaacggttttcccgcgctcccggctATG

    CV0476 Gene: CV0476     GI: 34495931     BI number: CV0476     GOG: -------     Description: conserved hypothetical protei            aa           a  a           a  t           g  g            gc            at            gc           a  |            at            gc            cg           a  c           a  a           a  c            gt            ta            gc            tg   t       a  g a  g      a  a g  a      c  a at       a  g cg       g  a cg       a  | gc        gc cg        gc         c cg        tg       c  g gc       a  |       gc gc        gc        cg t  t       gc        cg a  c      t  |       gc a  a      t  |       cg a  a      g  |      |  a a  g      a  |      |  t a  |      a  |      |  a at       c  |      c  a at       t  |      a  a cg       c  |      g  g g  g       cg        at g  a       gc        at gt        gc        gc cg        cg        gc cg        gc        cg                         gactttttgcaaaaatctgccacgccgccgcaaacggttttcccgcgctcccggctATG     ..................................................................................................................