                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-17.10 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-18.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCCTTAGCGCCGATGATAGTGTGGCATTCGCCATGTGAAAGTAGGACACCGCCAga
cgccccatacgcagaaccccagctcagacgagctggggtttttgcattgtgcgcgcggatcgcgcgacttcctgcccgtttccatgaaaaaccccgccag
ttgcctggcggggctttgctgtttccggcttgcaagctggcctgccgtccatcgccggcatccatccttttgtcggaggcgtcgccatttgccatgtcca
cgcggctatgctggaaatgacagtggggcaatggaggctgggATG

    CV0479 --- CV0480 --- CV0481 Gene: CV0479     GI: 34495934     BI number: CV0479     GOG: COG4967     Description: probable type-4 fimbrial biogenesis protein Gene: CV0480     GI: 34495935     BI number: CV0480     GOG: COG4966     Description: conserved hypothetical protein Gene: CV0481     GI: 34495936     BI number: CV0481     GOG: -------     Description: hypothetical protei            tt           t  c            gc            tg            cg            gc           |  t           |  t           |  g           t  c            ta            ta            cg tg        gc t  c      |  t       at gc       |  g      c  c at       |  g      c  g cg        gc       t  c cg        gc        gc gc        gt        cg cg        cg        cg cg        gc        gc cg        gc        ta cg        tg       c  t a  c      c  t      c  | at       c  c       gc at        gc        gc at        ta        ta                         tccttttgtcggaggcgtcgccatttgccatgtccacgcggctatgctggaaatgacagtggggcaatggaggctgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG4967 Tfp pilus assembly protein PilV ... can be seen here [NU] COG4966 Tfp pilus assembly protein PilW ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.90 kcal/mol                                                                         Nomenclature/Definitions ACGCCTTAGCGCCGATGATAGTGTGGCATTCGCCATGTGAAAGTAGGACACCGCCAga cgccccatacgcagaaccccagctcagacgagctggggtttttgcattgtgcgcgcggatcgcgcgacttcctgcccgtttccatgaaaaaccccgccag ttgcctggcggggctttgctgtttccggcttgcaagctggcctgccgtccatcgccggcatccatccttttgtcggaggcgtcgccatttgccatgtcca cgcggctatgctggaaatgacagtggggcaatggaggctgggATG     CV0479 --- CV0480 --- CV0481 Gene: CV0479     GI: 34495934     BI number: CV0479     GOG: COG4967     Description: probable type-4 fimbrial biogenesis protein Gene: CV0480     GI: 34495935     BI number: CV0480     GOG: COG4966     Description: conserved hypothetical protein Gene: CV0481     GI: 34495936     BI number: CV0481     GOG: -------     Description: hypothetical protei           ga          a  c           cg           ta           cg           gc           at           cg           cg           cg           cg             tttttgcattgtgcgcgcggatcgcgcgacttcctgcccgtttccatgaaaaaccccgccagttgcctggcggggctttgctgtttccggcttgcaagctggcctgccgtccatcgccggcatccatccttttgtcggaggcgtcgccatttgccatgtccacgcggctatgctggaaatgacagtggggcaatggaggctgggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG4967 Tfp pilus assembly protein PilV ... can be seen here [NU] COG4966 Tfp pilus assembly protein PilW ... can be seen here     ..................................................................................................................