                                                                        Gene putatively regulated by attenuation in C_violaceum

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-17.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caacggtaaggcctggtgcgtaggcgcccaggcggcgcagagccactgttttgggcgcgtgttcacgatctttcgcctggcgttgccggaaaagacggag
agcaggcttccagaatgggaaggcgcgccgccggcaaggcccagcccggagaccggcctgcgtcgccccggccggaagccggtggaccactggagtttcg
cggggaggcgattcgacaggcgttccggttctgccgtgccgtcctttgctgctgttgccctcttcgcactcaacgttttcatatcgtggagtgtgttttc
ATG

    CV0494 --- cobU --- CV0496 --- CV0497 --- CV0498 Gene: CV0494     GI: 34495949     BI number: CV0494     GOG: COG4206     Description: probable outer membrane receptor protein Gene: cobU     GI: 34495950     BI number: CV0495     GOG: COG2087     Description: cobalamin biosynthesis bifunctional protein: cobinamide kinase and cobinamide phosphate guanylyltransferase Gene: CV0496     GI: 34495951     BI number: CV0496     GOG: COG0614     Description: probable substrate-binding periplasmatic (PBP) ABC transporter protein Gene: CV0497     GI: 34495952     BI number: CV0497     GOG: -------     Description: hypothetical protein Gene: CV0498     GI: 34495953     BI number: CV0498     GOG: COG3027     Description: conserved hypothetical protei   c t  t t  g gc gc cg c  | t  | t  | gt cg gc gc a  | cg         t at       c  g gc       g  t c  |      t  t t  |       cg         c t  |       gc       t  a a  |      t  c      t  t g  |      t  c      t  a c  |      t  t      t  t gc       c  c       gc gt       c  t       cg at       t  t       at gt        gc       a  g g  g       cg        cg gc       c  |       ta gt        gc        cg cg        ta        at gc        gc        cg                         tgttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG4206 Outer membrane cobalamin receptor protein ... can be seen here [H] COG2087 Adenosyl cobinamide kinase/adenosyl cobinamide phosphate guanylyltransferase ... can be seen here [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [S] COG3027 Uncharacterized protein conserved in bacteria ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................