                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-19.40 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACCGCCAGGTGAAGGCGCTGGCCAACAGCGTGCAGGTCAAACTGAAGGAAGCCGGCG
TGGACATCGTCGGCAGCGAAGGCCACGAAAGCGGCGAATGGGTGCTGGTGGACGCCGG
CGACGTGGTGGTGCACGTGATGCTGCCCGCCGTGCGCGACTACTACGACATCGAGGCG
CTGTGGGGCGGCCAGAAGCCCAGCTTCGCCGTCGGCGCGGCCAAACCCTGGTCCGCGG
TGTAAgcaggccggagggcgggagcttcccgcccttttgtttttccccctccgcacaagcccttcccgATG

    CV0517 Gene: CV0517     GI: 34495972     BI number: CV0517     GOG: COG1576     Description: conserved hypothetical protei             G           T  T           G  A           G  A            Cg            Gc           C  a            Cg            Tg            Gc   C        Gc A  C       Tg A  C       Cg         c AT       |  a      g  t CG        Cg       a  t CG        Cg        gc |  T      A  g       gc GC       A  c       gc GC       A  g       cg CG        Cg        gc GC        Cg        gc CG       G  a       gc G  G      G  |       at GT        Cg        gt CG        Gc        gt                         tgtttttccccctccgcacaagcccttcccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1576 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................