                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:131 nt.    Distance to gene:53 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -6.70 kcal/mol
Antiterminator:    Distance from promoter:71 nt. Size=72 nt.     Delta G=-30.10 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=52 nt.     Delta G=-23.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAA-TACAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAAATCGAACGGCTTCCGGTACAATCCGCCCCCTGGCCCTGCCGCCGCTCGACCTG
TCCGCCACCCGCCTGAGGGCGCGGCTGGCCGCCGACGAGCCGGTGGACGGCCTGATAG
ACCCCGCCGTGCTGGCCTACATCCGCCGGCAGCGGCTATACCGGTAAggcaccgccctacccgct
cttttggtacctcttgccggcgcctgtgcctgctatgtaccggcacaggaaaaggaatcATG

    CV0518 Gene: CV0518     GI: 34495973     BI number: CV0518     GOG: COG0799     Description: conserved hypothetical protei            CA           A  T           T  C           C  C            CG            GC            GC   G        TG A  C       CG GC        GC CG        TA A  G      G  | GT       C  | CG        CG CG        GC |  A       CG GC        CG CG       C  | CG       C  | GC       A  | GC        GC |  T       AT |  G       TA |  A       AT |  T      |  A |  A      G  C |  G      T  C |  A       CG |  C       CG |  C       GT         c |  C      G  A      a  c T  C      C  A       cg CG       A  g       gc GC       G  g       gc GC        Gc       A  c CG        Ta        At GT        Gc        Ta CG        Gc        Gc GC        Cg        Gc                         cgctcttttggtacctcttgccggcgcctgtgcctgctatgtaccggcacaggaaaaggaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0799 Uncharacterized homolog of plant Iojap protein ... can be seen here     ..................................................................................................................