                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:164 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-12.50 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-18.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctcaaacgcaatatgtgaatcacatgcttgacagccccatccgattgccgcaccattaccgcgtcgtgttcaatagcgcgaccgggtttggcgacctgaa
cagtaaggcggacagccgcctattgcggctatttttacgtccgtcacacaccgttggtgcgtccttttctatggcgggccgtggtggggatacctacggg
tatgccggttccttactgccggttcgccaaccctgccatgcgcccgccaccctcgtttggcgacgaggaccgggcttaacgctcagtagggaggctcaac
ATG

    CV0643 --- CV0642 --- CV0641 Gene: CV0643     GI: 34496098     BI number: CV0643     GOG: -------     Description: hypothetical protein Gene: CV0642     GI: 34496097     BI number: CV0642     GOG: -------     Description: hypothetical protein Gene: CV0641     GI: 34496096     BI number: CV0641     GOG: NOG28414     Description: conserved hypothetical protei aa c  t       gg t  a      t  c tg        tg gc        ta tg        gc gc        gc cg        gt ta        cg        ca gc       c  a      a  g c  |      a  a       gc gc       g  c       gc cg       c  a       cg c  |      g  |       gc a  |       cg        gc t  |       gt       a  | t  |      |  a       at a  |      a  a       ta cg       t  g       gt cg       a  g       at at       a  c       cg c  t       cg       a  | gt        tg       a  | cg        ta        gc cg        gc        tg gc        ta        cg                         ctatttttacgtccgtcacacaccgttggtgcgtccttttctatggcgggccgtggtggggatacctacgggtatgccggttccttactgccggttcgccaaccctgccatgcgcccgccaccctcgtttggcgacgaggaccgggcttaacgctcagtagggaggctcaacATG     ..................................................................................................................